FastQCFastQC Report
Sun 7 Jun 2020
SRX5299025_1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
FilenameSRX5299025_1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences69259310
Sequences flagged as poor quality0
Sequence length151
%GC42

[OK]Per base sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCATACAATCTCGTAT1863930.2691233857224393TruSeq Adapter, Index 22 (97% over 37bp)

[OK]Adapter Content

Adapter graph